Using DNA similarities -Model answers (Activity 2)

IB Biology: Using DNA similarities -Model answers (Activity 2)

Species A: CATCATCATCATCATCATCATCATCATCATSpecies B: CATCATTACTACTACTACCATCATCATCATSpecies C: CATCATTACTACTACTACCATCATTATCATIn the DNA of these species there looks to have been two mutations. Of course both of these mutations could have happened in reverse. TAC could have become CAT and T could have become C. Is it possible to identify which base sequence came first?


To access the entire contents of this site, you need to log in or subscribe to it..

Click the free stuff button on the home page to access free pages or check the blog (which is also free).

All materials on this website are for the exclusive use of teachers and students at subscribing schools for the period of their subscription. Any unauthorised copying or posting of materials on other websites is an infringement of our copyright and could result in your account being blocked and legal action being taken against you.