Using DNA similarities -Model answers (Activity 2)
Species A: CATCATCATCATCATCATCATCATCATCATSpecies B: CATCATTACTACTACTACCATCATCATCATSpecies C: CATCATTACTACTACTACCATCATTATCATIn the DNA of these species there looks to have been two mutations. Of course both of these mutations could have happened in reverse. TAC could have become CAT and T could have become C. Is it possible to identify which base sequence came first?The quick answer: Using a cladogram, yes,it is possible...
To access the entire contents of this site, you need to log in or subscribe to it.
Alternatively, you can request a one month free trial.